pYM39- EYFP Plasmid


  • Model: PVT4016
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pYM39-EYFP,Plasmid pYM39-EYFP,pYM39-EYFP vector


pYM39-EYFP Multiple cloning site



pYM39-EYFP Information

Promoter: SP6, TEF, T7

Replicon: ori

Terminator: ADH1

Plasmid classification: yeast series, Pichia pastoris expression vector

Plasmid size: 4946bp

Plasmid tagging: EYFP

Prokaryotic resistance: Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: yeast cells

5'sequencing primers: T7:TAATACGACTCACTATAGGG

Primers for 3'sequencing: primers designed based on sequences



pYM39-EYFP Sequence

LOCUS       Exported                4946 bp ds-DNA     circular SYN 19-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 10
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4946)
  TITLE     Direct Submission
  JOURNAL   Exported Monday, September 19, 2016 from SnapGene Viewer 3.2.1
FEATURES             Location/Qualifiers
     source          1..4946
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             79..795
                     /product="enhanced YFP"
                     /note="mammalian codon-optimized"
     CDS             802..828
                     /product="HA (human influenza hemagglutinin) epitope tag"
     terminator      861..1048
                     /gene="S. cerevisiae ADH1"
                     /note="ADH1 terminator"
                     /note="transcription terminator for the S. cerevisiae 
                     alcohol dehydrogenase 1 (ADH1) gene"
     gene            1123..2479
                     /note="yeast selectable marker conferring kanamycin 
                     resistance (Wach et al., 1994)"
     promoter        1123..1466
                     /note="TEF promoter"
                     /note="Ashbya gossypii TEF promoter"
     CDS             1467..2276
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin"
     terminator      2282..2479
                     /note="TEF terminator"
                     /note="Ashbya gossypii TEF terminator"
     promoter        complement(2584..2602)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     rep_origin      complement(2860..3448)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(3619..4479)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4480..4584)
                     /note="AmpR promoter"
     promoter        4930..2
                     /note="SP6 promoter"
                     /note="promoter for bacteriophage SP6 RNA polymerase"
        1 gaacgcggcc gccagctgaa gcttcgtacg ctgcaggtcg acggatccgg agcaggtgct
       61 ggtgctggtg ctggagcaat gagcaagggc gaggagctgt tcaccggggt ggtgcccatc
      121 ctggtcgagc tggacggcga cgtaaacggc cacaagttca gcgtgtccgg cgagggcgag
      181 ggcgatgcca cctacggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc
      241 gtgccctggc ccaccctcgt gaccaccttc ggctacggcg tgcagtgctt cgcccgctac
      301 cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacgtccag
      361 gagcgcacca tcttcttcaa ggacgacggc aactacaaga cccgcgccga ggtgaagttc
      421 gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc
      481 aacatcctgg ggcacaagct ggagtacaac tacaacagcc acaacgtcta tatcatggcc
      541 gacaagcaga agaacggcat caaggtgaac ttcaagatcc gccacaacat cgaggacggc
      601 agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg ccccgtgctg
      661 ctgcccgaca accactacct gagctaccag tccgccctga gcaaagaccc caacgagaag
      721 cgcgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactct cggcatggac
      781 gagctgtaca agtaaggatc ctatccatat gacgttccag attacgctgc tcagtgctag
      841 ggcgcgccac ttctaaataa gcgaatttct tatgatttat gatttttatt attaaataag
      901 ttataaaaaa aataagtgta tacaaatttt aaagtgactc ttaggtttta aaacgaaaat
      961 tcttattctt gagtaactct ttcctgtagg tcaggttgct ttctcaggta tagtatgagg
     1021 tcgctcttat tgaccacacc tctaccggca gatccgctag ggataacagg gtaatataga
     1081 tctgtttagc ttgcctcgtc cccgccgggt cacccggcca gcgacatgga ggcccagaat
     1141 accctccttg acagtcttga cgtgcgcagc tcaggggcat gatgtgactg tcgcccgtac
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
