pYX-Asc-Sox4-m

$280.00

  • Model: PVT20035
  • 20 Units in Stock
Ask a question


Add to Cart:

pYX-Asc-Sox4-m

PVT20035    2ug

 

Product Name:pYX-Asc-Sox4-m
Replicon: pUC
Prokaryotic resistance: Amp
Resistance Marker: -
Host: Escherichia coli
Vector type: Gene template
Fragment type: cDNA
species: Mouse
Prokaryotic resistance: Amp
Resistance Marker:
Fluorescent labeling:

 

pYX-Asc-Sox4-m Sequence

Mus musculus SRY (sex determining region Y)-box 4 (Sox4), mRNA
NCBI Reference Sequence: NM_009238.3;BC052736.1


                     /gene="Sox4"
                     /gene_synonym="AA682046; Sox-4"


atggtacaacagaccaacaacgcggagaacactgaggctctgctggccggggagagctcggactcgggcgccggcctggagctgggcatcgcgtcctccccgacgcctggctccaccgcgtcgacgggcggcaaggcggacgaccccagctggtgcaagacgcccagtggccacatcaagcggcccatgaacgcctttatggtgtggtcgcagatcgagcggcgcaagatcatggagcagtcgcccgacatgcacaacgccgagatctccaagcggctaggcaaacgctggaagctgctcaaggacagcgacaagattccgttcatccaggaggcggagcggctgcgcctcaagcacatggctgactaccctgactacaagtaccggccgcgaaagaaggtgaagtcgggcaacgcgggcgcgggatcggcggccacagccaagccaggggagaagggcgacaaggtcgcgggcagcagcggccacgcgggaagcagccacgcggggggtggcgcgggcggcagctccaagcccgcgcccaagaagagctgtggccccaaggtggcgggcagctcggtcggcaagccccacgctaagctggtcccggcgggcggcagcaaggcggctgcatcgttctctccagagcaagctgccctgctgcccctgggggagcccacggccgtctacaaggtgcggactcccagtgcggccactccggccgcctcctcctcgccgtccagtgcgctggccaccccagccaaacaccctgccgacaagaaagtgaagcgcgtctacctgtttggaagcctgggcgcttcggcgtctcccgtcgggggcctgggagcgagcgccgaccccagtgatccactggggttgtacgaagatggaggcccgggatgctcgcccgatggccggagtctgagcggccgcagcagcgcagcatcatcgccagccgccagccgatcgcccgctgaccaccgcggctacgccagcctacgcgcagcctcgcccgccccgtccagcgcgccctcgcacgcgtcctcctcgctctcctcgtcctcttcctcctcctcgggctcttcgtcgtccgacgacgagttcgaagacgacctgctcgacctgaaccccagctcaaactttgagagcatgtccctgggcagtttcagctcctcatcggcgctcgatcgggacctggattttaacttcgaacccggctcaggctcccacttcgaattcccggactattgcacgcccgaggtgagcgagatgatctcgggagattggctggagtccagcatctctaacctggtcttcacctactga
//

*For Lab research use only

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart