RNAi-Ready pSIREN-RetroQ-DsRed-Express

$280.00

  • Model: PVTY01205
  • 20 Units in Stock
Ask a question


Add to Cart:

RNAi-Ready pSIREN-RetroQ-DsRed-Express

PVTY01205  2ug

RNAi-Ready pSIREN-RetroQ-DsRed-Express Description

Plasmid type: RNAi vector Copy Number: Low copy Promoter: Human U6 Cloning Method: Multiple cloning sites,restriction endonuclease Size: 6543 bp 5' Sequencing primers and sequences: U6-F: ATGGACTATCATATGCTTACCGTA (Clontech ) Resistance(s): Ampicillin (Amp) Note: Expression of DsRed red red fluorescent protein as a marker of gene silencing.

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart